BBa_K771106 1 BBa_K771106 GBDligand 2012-09-23T11:00:00Z 2015-05-08T01:13:14Z Gene Synthesis components of interacting proteins false false _1023_ 0 12097 9 Not in stock false For membrane accelerator false Guo Huaqing BBa_K771106_sequence 1 gctgaggccgccgcaaaagaagcagcagctaaggaagctgcggcgaagctggtgggcgcgctgatgcatgtgatgcagaaacgcagccgcgcgattcatagcagcgatgaaggcgaagatcaggcgggcgatgaagatgaagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z