BBa_K772008 1 BBa_K772008 GFP - LacZ protein complex with flag tags 2012-09-25T11:00:00Z 2015-05-08T01:13:15Z Note that there is an RBS sequence just before the protein sequence in order to eliminate the need of addition of it. This part contains a green fluorescent protein (GFP) as a non-reactive chemical compound (anchor) in order to neutralize the active reactive fixed to it, a reporter device (LacZ enzyme catalyses the reaction of the cleavage of X-Gal which results with blue color change) and a TEV protease cleavage site between them to assemble these two proteins. BBa_772001 and BBa_K772002 are assembled to be used as the trigger of detection in the whole system which ends with the intracellular transfection (or activation) of TEV protease. After the activation, it is planned that TEV protease will cleave this anchor-inducer protein complex to release free the reporter. In conclusion, in this system, the inducer would activate a transcription pathway on the targeted inducible gene or the reporter would indicate that there is a change in the whole system. This part contains flag tags extra from BBa_K772006 in the GFP region; because it is planned to be used in the Co-IP/SDS-PAGE assay to be isolated. false false _1024_ 0 9573 9 Not in stock false Cleavage site, LacZ and GFP sequences are gathered from Registry. false Mustafa Elitok annotation2203915 1 Double Terminator range2203915 1 1102 1232 annotation2203913 1 TEV cleavage site range2203913 1 768 857 annotation2203914 1 LacZ range2203914 1 858 1101 annotation2203912 1 GFP range2203912 1 47 767 annotation2203910 1 RBS range2203910 1 1 20 annotation2203911 1 Flag Tag range2203911 1 21 46 annotation2203916 1 Anchor-Reporter + Flag range2203916 1 21 1101 BBa_K772008_sequence 1 ctagagaaagaggagaaatactagagactacaaagacgacgacgacaaaatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataagccgcggatcaagagcaggtggaggcggaggcggcggaggtggaggtgaaaatctttattttcaaggaggcaaactgggaggcggcggagaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z