BBa_C0012 1 lacI lacI repressor from E. coli (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Coding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator <bb_part>BBa_R0010</bb_part> and PLlac01 hybrid regulator <bb_part>BBa_R0011</bb_part> and inhibits transcription. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, therefore promoting transcription.</P> <P>A rapid degredation tail (LVA) has been added to improve the High to Low performance of this part.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P> References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P>Sequence taken from the repressilator of Elowitz and Leibler (2000). The obtained sequence was compared to the wild-type sequence for LacI obtained through a database search. The sequence had been modified from the wild-type in that wild-type GTG start was changed to an ATG start (note, actual ORF in E.coli has several GTG starts it would seem). The LVA tag has been added for quicker degradation.<P> Incompatible with systems containing LacI, lactose, or IPTG. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation2213988 1 Help:Barcodes range2213988 1 1129 1153 annotation7031 1 BBa_C0012 range7031 1 1 1128 annotation1722 1 LVA range1722 1 1090 1128 annotation1723 1 lacI-LVA range1723 1 1 1128 BBa_K772104 1 BBa_K772104 pLac IPTG inducible generator 2012-10-04T11:00:00Z 2015-05-08T01:13:15Z Registry This part is an inverting regulator sensitive to LacI and CAP. It contains two protein binding sites. The first binds the CAP protein, which is generally present in E.coli and is asocciated with cell health and availability of glucose. The second binds LacI protein. This part also produces LacI protein as an oscillator which results that as LacI protein is synthesized, the promoter wil be inhibited until the presence of IPTG. The inhibition will decrease the production of LacI which leads to the synthesis of this inhibitor. >In the absence of LacI protein and CAP protein, this part promotes transcription. >In the presence of LacI protein and CAP protein, this part inhibits transcription. >LacI can be inhibited by IPTG. >LacI is coded by BBa_C0010 false false _1024_ 0 9573 9 Not in stock false Note that this part is not working unless IPTG is present in the media. false Mustafa Elitok component2248261 1 BBa_C0012 component2248259 1 BBa_J04500 annotation2248259 1 BBa_J04500 range2248259 1 1 220 annotation2248261 1 BBa_C0012 range2248261 1 227 1354 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961225 1 -10 range1961225 1 161 166 annotation1961224 1 -35 range1961224 1 137 142 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961226 1 LacI binding site range1961226 1 166 200 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508159 1 BBa_B0034 component1508149 1 BBa_R0010 annotation1508149 1 BBa_R0010 range1508149 1 1 200 annotation1508159 1 BBa_B0034 range1508159 1 209 220 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K772104_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_C0012_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z