BBa_K777122 1 BBa_K777122 yhjH under the control of constitutive promoter J23100 2012-09-20T11:00:00Z 2015-05-08T01:13:17Z * ''yhjH'' was amplified from genomic DNA of ''E. coli'' str. K-12 substr. DH10B, complete genome (CP000948.1). * J23100 information was taken from the partsregistry and physical DNA from the 2012 distribution kit. The product of this gene is a phosphodiesterase which is involved in regulating the levels of c-di-GMP, a bacterial signaling molecule. High levels of c-di-GMP promote biofilm synthesis and inhibit flagella by binding to YcgR which then acts as a "brake" on FliG and FliM. Levels of c-di-GMP are elevated and motility is reduced in ''yhjH''-mutants. <br> Here we used 3 different constitutive [http://partsregistry.org/Part:BBa_J23100 Anderson promoters] from the 2006 Berkeley group to test how different levels of constitutive ''yhjH'' expression affect the motility of ''E. coli''. <br><br> false false _1029_ 0 12106 9 Not in stock false * ''yhjH'' was amplified from genomic DNA of ''E. coli'' DH10B via PCR using the following primers: ** Fwd: 5'-gtttcttcgaattcgcggccgcttctagatgataaggcaggttatccagc-3' ** Rev: 5'-gtttcttcctgcagcggccgctactagtattatagcgccagaaccgccgtattcagc-3' false Team Goettingen component2191155 1 BBa_B0034 component2191157 1 BBa_K777121 component2191153 1 BBa_J23100 annotation2191157 1 BBa_K777121 range2191157 1 62 829 annotation2191155 1 BBa_B0034 range2191155 1 44 55 annotation2191153 1 BBa_J23100 range2191153 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K777121 1 BBa_K777121 yhjH 2012-09-17T11:00:00Z 2015-05-08T01:13:17Z The part was amplified from genomic DNA of E. coli str. K-12 substr. DH10B, complete genome (CP000948.1). Released HQ 2013 The product of this gene is a phosphodiesterase which is involved in regulating the levels of c-di-GMP, a bacterial signaling molecule. High levels of c-di-GMP promote biofilm synthesis and inhibit flagella by binding to YcgR which then acts as a "brake" on FliG and FliM. Levels of c-di-GMP are elevated and motility is reduced in ''yhjH''-mutants. false true _1029_ 0 12106 9 In stock true * ''yhjH'' was amplified from genomic DNA of ''E. coli'' DH10B via PCR using the following primers: ** Fwd: 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGATAAGGCAGGTTATCCAGC-3' ** Rev: 5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATAGCGCCAGAACCGCCGTATTCAGC-3' false Flash Coli annotation2184528 1 YhjH coding sequence range2184528 1 1 768 annotation2184529 1 start range2184529 1 1 1 annotation2184530 1 stop range2184530 1 768 768 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K777121_sequence 1 atgataaggcaggttatccagcgaataagcaaccctgaagcaagcatcgagagcttgcaggaacggcgtttttggttgcagtgtgagcgtgcttacacctggcagccgatctatcaaacatgcgggcggttaatggccgtggagctattaacggtggtcacgcatcccttgaacccttcgcaacgcctgccgccggatcgctattttactgaaatcaccgtcagccatcggatggaggttgtgaaagagcagattgatttgctggcgcaaaaagccgacttctttatagagcacggcctgctggcatcggtcaatattgatggccctacgctcatcgccctgcgtcagcaaccaaaaatcctgcgccagattgagcgtcttccctggctgcgtttcgaactggtggagcatatccgtctgccgaaagattcaacctttgcctcgatgtgtgaatttggcccgctgtggctggatgattttggtaccgggatggcaaatttctctgcgctaagtgaagtgcgttatgactacatcaaaatcgcgcgagaactgtttgtgatgctgcgtcagtcgccggaaggacgcacactcttttctcagcttttacatctaatgaatcgctattgtcgcggggtgattgtcgagggcgtagaaacgccggaagagtggcgtgatgttcagaactcgcccgcattcgccgcacaaggctggtttctttcacgcccggcaccgatagaaacgctgaatacggcggttctggcgctataa BBa_K777122_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgataaggcaggttatccagcgaataagcaaccctgaagcaagcatcgagagcttgcaggaacggcgtttttggttgcagtgtgagcgtgcttacacctggcagccgatctatcaaacatgcgggcggttaatggccgtggagctattaacggtggtcacgcatcccttgaacccttcgcaacgcctgccgccggatcgctattttactgaaatcaccgtcagccatcggatggaggttgtgaaagagcagattgatttgctggcgcaaaaagccgacttctttatagagcacggcctgctggcatcggtcaatattgatggccctacgctcatcgccctgcgtcagcaaccaaaaatcctgcgccagattgagcgtcttccctggctgcgtttcgaactggtggagcatatccgtctgccgaaagattcaacctttgcctcgatgtgtgaatttggcccgctgtggctggatgattttggtaccgggatggcaaatttctctgcgctaagtgaagtgcgttatgactacatcaaaatcgcgcgagaactgtttgtgatgctgcgtcagtcgccggaaggacgcacactcttttctcagcttttacatctaatgaatcgctattgtcgcggggtgattgtcgagggcgtagaaacgccggaagagtggcgtgatgttcagaactcgcccgcattcgccgcacaaggctggtttctttcacgcccggcaccgatagaaacgctgaatacggcggttctggcgctataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z