BBa_K777125 1 BBa_K777125 Constitutive J23100 promoter 2012-09-18T11:00:00Z 2015-05-08T01:13:17Z * pSB1C3 and the Anderson promoters were taken from the distribution kit 2012. (part J61002 with different constitutive promoters and pSB1C3) This part is a combination of a constitutive Anderson promoter with the downstream RFP (for more information check out J61002 and J23100) and the plasmid backbone pSB1C3. false false _1029_ 0 12106 9 It's complicated false * No specific design considerations false Team Goettingen annotation2203710 1 J23100 range2203710 1 2 36 annotation2203711 1 constitutive promoter J23100 range2203711 1 2 36 BBa_K777125_sequence 1 gttgacggctagctcagtcctaggtacagtgctagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z