BBa_K777127 1 BBa_K777127 Constitutive J23105 promoter 2012-09-19T11:00:00Z 2015-05-08T01:13:17Z pSB1C3 and the Anderson promoters were taken from the distribution kit 2012. (part J61002 with different constitutive promoters and pSB1C3) [[Image:Table_K777125-K777132.jpg|thumb|300px|right|'''Fig. 1:''' Overview of our related BioBricks with Anderson promoters and RFP in pSB1C3. (Activity according to Berkeley 2006)]] This part is a combination of a constitutive Anderson promoter with the downstream RFP (for more information check out [http://partsregistry.org/Part:BBa_J61002 J61002] and [http://partsregistry.org/Part:BBa_J23105 J23105]) and the plasmid backbone pSB1C3. false false _1029_ 0 12106 9 It's complicated false No specific design considerations false Team Goettingen annotation2204848 1 J23105 range2204848 1 2 36 annotation2204849 1 constitutive promoter J23105 range2204849 1 2 36 BBa_K777127_sequence 1 gtttacggctagctcagtcctaggtactatgctagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z