BBa_K777132 1 BBa_K777132 Constitutive J23114 promoter 2012-09-19T11:00:00Z 2015-05-08T01:13:17Z * pSB1C3 and the Anderson promoters were taken from the distribution kit 2012. (part J61002 with different constitutive promoters and pSB1C3) [[Image:Table_K777125-K777132.jpg|thumb|300px|right|'''Fig. 1:''' Overview of our related BioBricks with Anderson promoters and RFP in pSB1C3. (Activity according to Berkeley 2006)]] This part is a combination of a constitutive Anderson promoter with the downstream RFP (for more information check out [http://partsregistry.org/Part:BBa_J61002 J61002] and [http://partsregistry.org/Part:BBa_J23114 J23114]) and the plasmid backbone pSB1C3. false false _1029_ 0 12106 9 It's complicated false * No specific design considerations false Team Goettingen annotation2204948 1 J23114 range2204948 1 2 36 annotation2204949 1 constitutive promoter J23114 range2204949 1 2 36 BBa_K777132_sequence 1 gtttatggctagctcagtcctaggtacaatgctagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z