BBa_K778012 1 BBa_K778012 LacI binding sites (including 6 binding sites) 2012-09-25T11:00:00Z 2015-05-08T01:13:17Z Artificial DNA synthesis LacI binding sites (including 8 binding sites) for inhibition of LacI. false false _1032_ 0 13134 9 Not in stock false Simple tandem repeat of binding sites is difficult to synthesize. Biobrick part of tandem repeats should be designed by combining several sequences. false Yuka Yamazaki annotation2211536 1 LacZp-2 range2211536 1 22 42 annotation2211539 1 LacZp-3 range2211539 1 106 126 annotation2211537 1 LacZp-2 range2211537 1 85 105 annotation2202683 1 LacZp-1 range2202683 1 1 21 annotation2211538 1 LacZp-3 range2211538 1 43 63 annotation2202685 1 LacZp-1 range2202685 1 64 84 BBa_K778012_sequence 1 aattgtgagcggataacaattggcagtgagcgcaacgcaattggttgttactcgctcacatttaattgtgagcggataacaattggcagtgagcgcaacgcaattggttgttactcgctcacattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z