BBa_K779109 1 BBa_K779109 Gate 3 - mRNA domain 3 DNA sensor MammoBlock 2012-09-29T11:00:00Z 2015-05-08T01:13:17Z De novo design Description to be completed by MIT iGEM 2012 soon. false false _1033_ 0 13874 9 Not in stock false Design considerations false Divya Israni BBa_K779109_sequence 1 tcttctgcttgacggccatgagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z