BBa_K779122 1 BBa_K779122 Short DNA reporter bottom strand (with ROX fluorophore) MammoBlock 2012-09-29T11:00:00Z 2015-05-08T01:13:17Z Qian L., Winfree E. Scaling up digital circuit computation with DNA displacement cascades., Science. 2011 Jun 3; 332 (6034):1196-201 Description to be completed by MIT iGEM 2012 soon. false true _1033_ 0 13874 9 Not in stock false Design considerations false Divya Israni annotation2205500 1 T* Toehold Domain range2205500 1 1 5 annotation2205501 1 S6* Domain range2205501 1 6 20 BBa_K779122_sequence 1 tgagatgtgattgtgttatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z