BBa_K779315 1 BBa_K779315 5' Hammerhead with loss-of-function mutation MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z Sequence from Figure 1 of "Hammerhead ribozyme design and application", M. Amarzguioui and H. Prydz 1998. To be completed by MIT iGEM 2012. false false _1033_ 0 13050 9 Not in stock false To be completed by MIT iGEM 2012. false Felix Sun annotation2204170 1 BsaI Recognition range2204170 1 182 187 annotation2204162 1 Loss-of-function mutation range2204162 1 54 56 annotation2204167 1 BsaI Recognition range2204167 1 4 9 annotation2204168 1 Q1 Site (Golden Gate) range2204168 1 11 14 annotation2204160 1 Non-folding sequence range2204160 1 16 47 annotation2204161 1 Hammerhead range2204161 1 48 106 annotation2204163 1 Non-folding sequence range2204163 1 107 175 annotation2204173 1 QX site (Golden Gate) range2204173 1 177 180 BBa_K779315_sequence 1 aaaggtctcaaggtaaataaaatcacaacacactccaacaccaccaacatacgagagagcgtgatacccgctcactgaagatggcccggtagggccgaaacgtactaatccccacaatcaaatcccaccacactcccaaccccaaatccatacccactcacccctcctccttaaaagctttgagaccttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z