BBa_K779317 1 BBa_K779317 5' Hammerhead MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z To be completed by MIT iGEM 2012. To be completed by MIT iGEM 2012. false false _1033_ 0 13050 9 Not in stock false To be completed by MIT iGEM 2012. false Felix Sun annotation2204189 1 BsaI recognition range2204189 1 182 187 annotation2204181 1 Q1 site (Golden Gate) range2204181 1 11 14 annotation2204179 1 BasI recognition range2204179 1 4 9 annotation2204187 1 QX sute (Golden Gate) range2204187 1 177 180 annotation2204183 1 Non-folding sequence range2204183 1 16 47 annotation2204186 1 Non-folding sequence range2204186 1 107 175 annotation2204185 1 Hammerhead range2204185 1 48 106 BBa_K779317_sequence 1 aaaggtctcaaggtaaataaaatcacaacacactccaacaccaccaacatacgtctgagcgtgatacccgctcactgaagatggcccggtagggccgaaacgtactaatccccacaatcaaatcccaccacactcccaaccccaaatccatacccactcacccctcctccttaaaagctttgagaccttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z