BBa_K779318 1 BBa_K779318 3' Hammerhead MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z To be completed by MIT iGEM 2012. To be completed by MIT iGEM 2012. false true _1033_ 0 13050 9 Not in stock false To be completed by MIT iGEM 2012. false Felix Sun annotation2204216 1 Q1 site (Golden Gate) range2204216 1 11 14 annotation2204219 1 Non-folding sequence range2204219 1 139 171 annotation2204218 1 Hammerhead range2204218 1 85 138 annotation2204221 1 BsaI recognition range2204221 1 178 183 annotation2204217 1 Non-folding sequence range2204217 1 16 84 annotation2204215 1 BsaI recognition range2204215 1 4 9 annotation2204220 1 QX site (Golden Gate) range2204220 1 173 176 BBa_K779318_sequence 1 aaaggtctcaaggtaaatccccacaatcaaatcccaccacactcccaaccccaaatccatacccactcacccctcctccttaaatgcaaagccgggatggcccggtagaagtcactcgcccatagtgcgagagagcagaataaaatcacaacacactccaacaccaccaacagctttgagaccttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z