BBa_K779500 1 BBa_K779500 Long reporter top strand with bulge MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z De novo design. Released HQ 2013 Reporter top strand with a 4nt bulge. Modifications: 5' RQ quencher, 3' Alexa florophore, all bases modified with 2'O Methyl (ordered as a DNA oligo with Us instead of Ts). IDT DNA oligo order: /5IAbRQ/mCmA mCmCmC mAmCmU mCmCmC mAmCmU mUmCmU mCmCmC mAmCmC mA/3AlexF488N/ false false _1033_ 0 12684 9 In stock false Sequence designed to be orthogonal to the HEK293 transcriptome, and to have a high melting temperature. 4-nucleotide bulge added 10-nt from the 3' end as a potential protection mechanism from cleavage by RISC as suggested by Iba et al. (2011). See more details at the MIT iGEM wiki: http://2012.igem.org/Team:MIT false Kristjan Eerik Kaseniit annotation2204233 1 Domain Sa part 1 range2204233 1 1 10 annotation2204232 1 Domain Sb range2204232 1 1 24 annotation2204231 1 Bulge range2204231 1 11 14 annotation2204234 1 Domain Sa part 2 range2204234 1 15 24 BBa_K779500_sequence 1 cacccactcccacttctcccacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z