BBa_K779501 1 BBa_K779501 Long reporter top strand MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z De novo design. Released HQ 2013 Reporter top strand. Modifications: 5' RQ quencher, 3' Alexa florophore, all bases modified with 2'O Methyl (ordered as a DNA oligo with Us instead of Ts). IDT DNA oligo order: /5IAbRQ/mCmA mCmCmC mAmCmU mCmCmU mCmUmC mCmCmA mCmCmA /3AlexF488N/ false false _1033_ 0 12684 9 In stock true Sequence designed to be orthogonal to the HEK293 transcriptome, and to have a high melting temperature. See more details at the MIT iGEM wiki: http://2012.igem.org/Team:MIT false Kristjan Eerik Kaseniit annotation2204235 1 Domain Sa range2204235 1 1 20 BBa_K779501_sequence 1 cacccactcctctcccacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z