BBa_K779503 1 BBa_K779503 Long input strand MammoBlock 2012-09-28T11:00:00Z 2015-05-08T01:13:18Z De novo design. Released HQ 2013 Long matching input strand to the reporter formed by parts [[Part:BBa K779500]] and [[Part:BBa K779502]] or [[Part:BBa K779501]] and [[Part:BBa K779502]]. Modifications: 5' IRD800 fluorophore, 3' phosphate. IDT DNA oligo order: /5IRD800/mCmA mCmCmC mAmCmU mCmCmU mCmUmC mCmCmA mCmCmA mAmCmU mAmUmC mCmA/3Phos/ false false _1033_ 0 12684 9 In stock false 3' phosphate added to protect from some 3' exonucleases (suggested by IDT). See more details at the MIT iGEM wiki: http://2012.igem.org/Team:MIT false Kristjan Eerik Kaseniit annotation2204256 1 Toehold range2204256 1 21 28 annotation2204255 1 Domain Sa range2204255 1 1 20 BBa_K779503_sequence 1 cacccactcctctcccaccaactatcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z