BBa_K780000 1 BBa_K780000 Terminator for Bacillus subtilis 2012-09-25T11:00:00Z 2015-05-08T01:13:18Z Terminator of gyrase (EC 5.99.1.3) gene. Our terminator is based on strong, Rho-independent terminator of gyrase gene, which is type II topoisomerase (EC 5.99.1.3). DNA gyrase uses the energy of ATP hydrolysis to introduce negative supercoils or relaxes positive supercoils. Negative DNA supercoiling is essential in vivo to compact the genome, relieve torsional strain during replication, and promote local melting for vital processes such as transcript initation by RNA polymerase. Gyrase gene is an housekeeping gene and because of that it must have efficient terminator. false false _1034_ 0 10113 9 It's complicated false - false Nikodem Latocha BBa_K780000_sequence 1 aagaagaagtgtgaaaaagcgcagctgaaatagctgcgcttttttgtgtcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z