BBa_K783055 1 BBa_K783055 Level 0 MoClo Destination Vector with AB 2012-10-01T11:00:00Z 2015-05-08T01:13:21Z We amplified the alpha lacZ fragment from pUC19 and used the BioBrick pSB1C3 backbone for our vector backbone. This is a Level 0 MoClo destination vector with flanking sites A on the 5' side and site B on the 3' side of the alpha fragment of lacZ. The fusion site letters refer to 4bp fusion sites: A GGAG E GCTT B TACT F CGCT C AATG G TGCC D AGGT H ACTA false false _1038_ 0 8248 9 Not in stock false We had to confirm the lacZ orientation was 5'->3' after cloning. false Traci Haddock BBa_K783055_sequence 1 actagtactagtgggtctcaggagatgtcttctgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggaagacgttactagagacctactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z