BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_J33204 1 BBa_J33204 xylE reporter gene with rbs 2006-10-16T11:00:00Z 2015-08-31T04:08:46Z The template DNA was kindly supplied by Dr. Peter Williams of the University of Wales, Bangor. The primer design was based on Genbank sequence M64747 (GI:151718). The sequence reported here was confirmed by sequencing the Biobrick construct. Released HQ 2013 This part includes the xylE gene from the Pseudomonas putida TOL (naphthalene and xylene degradadative plasmid) pWW0. This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This is a useful reporter gene; colonies or broths expressing active XylE, in the presence of oxygen, will rapidly convert catechol, a cheap colourless substrate, to a bright yellow compound with an absorbance maximum around 377 nm. The part includes the native ribosome binding site, so simply needs to be added after a suitable promoter to act as a reporter. I have previously used this gene to generate whole cell biosensors for various heavy metals. Note that, unlike Xgal etc., catechol in solution is prone to spontaneous oxidation resulting in brown melanin-like polymeric products, so is not stable enough to incorporate into plates or growth media; it should be dripped onto colonies (I use 10 mM catechol in water for this) or added to liquid cultures at a final concentration of about 0.5 mM prior to assay. Note also that there is a SacI site at the very start of the part, when the prefix is included, so this can be used as a replacement vector to introduce PCR products with SacI-SpeI ends into pSB1A2 giving them full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. false false _63_ 0 837 63 In stock true Note that this sequence includes the native ribsomome binding site. Also, when the prefix is included, there is a SacI site at the start, which allows this part to be used as a vector for insertion of PCR products with SacI-SpeI ends into pSB1A2, replacing xylE, giving the full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. true Chris French annotation1903407 1 cds range1903407 1 27 950 annotation1903406 1 rbs range1903406 1 14 19 BBa_K784001 1 pT7_xyIE pT7_RBS_xyIE reporter gene 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z The RBS and xyIE genes are from the parts registry, made by iGEM2006_Edinburgh. The promoter and terminator are from: http://nar.oxfordjournals.org/content/early/2012/06/28/nar.gks597.full This part's purpose is to testify to the presence of the T7 RNA Polymerase by the xyIE reporter gene from iGEM2006_Edinburgh. It consists of an RNA T7 promoter, an RBS, a reporter gene- xyIE, and a T7 terminator. The assay for xyIE is very simple, refer to the xyIE basic part for instructions. The xyIE+RBS part is between XhoI and XmaI restriction sites, therefore can be excised by these enzymes. false false _1039_ 0 12190 9 It's complicated true No particular design considerations. false Noa Katz component2182766 1 BBa_J33204 component2182763 1 BBa_I719005 component2182767 1 BBa_K784002 annotation2182767 1 BBa_K784002 range2182767 1 998 1044 annotation2182763 1 BBa_I719005 range2182763 1 1 23 annotation2182766 1 BBa_J33204 range2182766 1 32 989 BBa_K784002 1 BBa_K784002 T7 Terminator 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z http://nar.oxfordjournals.org/content/suppl/2012/06/05/gks597.DC1/nar-00461-c-2012-File007.pdf This part is a T7 RNAP Terminator, which can also be used for the following RNAP: T3,N4,K1F,SP6. false false _1039_ 0 11982 9 Not in stock false no particular design considerations false Lior Levy BBa_K784001_sequence 1 taatacgactcactatagggagatactagagctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccggtactagagtagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_J33204_sequence 1 ctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccgg BBa_K784002_sequence 1 tagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z