BBa_K784003 1 BBa_K784003 T3 promoter 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z This part comes from the T3 Bacteriophage genome. This part has the T3 RNA Polymerase promoter. false false _1039_ 0 12190 9 Not in stock false There are no particular consideration I had to deal with. false Noa Katz BBa_K784003_sequence 1 taataaccctcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z