BBa_K784005 1 BBa_K784005 Theophylline riboswitch 12.1 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z The part was obtained from the <a href="http://www.gallivanlab.org/">Gallivan lab</a>. The description of the part was found in the following paper: Lynch Sean A., Gallivan Justin P. 2009. A flow cytometry-based screen for synthetic riboswitches. Nucleic Acids Research 37(1): 184-192. A riboswitch which is comprised of an aptamer which recognizes the ligand, theophylline. The riboswitch also contains an RBS. In the absence of theophylline, there is extensive base pairing in the 5' untranslated region (UTR) which blocks the RBS. This base pairing prevents translation of a gene downstream to the riboswitch. In the presence of theophylline, the transcript adopts a secondary structure in which the RBS is exposed, allowing translation to occur. false false _1039_ 0 11677 9 Not in stock false The part must be directly fused to the starting codon of the downstream coding region. false Ilya Vainberg Slutskin annotation2182923 1 Theophylline aptamer range2182923 1 18 55 annotation2182924 1 RBS range2182924 1 56 74 annotation2182922 1 Additional 5' UTR range2182922 1 1 17 BBa_K784005_sequence 1 gactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z