BBa_K784005 1 BBa_K784005 Theophylline riboswitch 12.1 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z The part was obtained from the <a href="http://www.gallivanlab.org/">Gallivan lab</a>. The description of the part was found in the following paper: Lynch Sean A., Gallivan Justin P. 2009. A flow cytometry-based screen for synthetic riboswitches. Nucleic Acids Research 37(1): 184-192. A riboswitch which is comprised of an aptamer which recognizes the ligand, theophylline. The riboswitch also contains an RBS. In the absence of theophylline, there is extensive base pairing in the 5' untranslated region (UTR) which blocks the RBS. This base pairing prevents translation of a gene downstream to the riboswitch. In the presence of theophylline, the transcript adopts a secondary structure in which the RBS is exposed, allowing translation to occur. false false _1039_ 0 11677 9 Not in stock false The part must be directly fused to the starting codon of the downstream coding region. false Ilya Vainberg Slutskin annotation2182922 1 Additional 5' UTR range2182922 1 1 17 annotation2182924 1 RBS range2182924 1 56 74 annotation2182923 1 Theophylline aptamer range2182923 1 18 55 BBa_K784006 1 BBa_K784006 Theophylline riboswitch 12.1 + mCherry 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z This part is a composite part of [[Part:BBa_K784005|BBa_K784005]] and [[Part:BBa_J06504|BBa_J06504]] Released HQ 2013 This part is a direct fusion of the theophylline riboswitch ([[Part:BBa_K784005|BBa_K784005]]) and the mCherry protein ([[Part:BBa_J06504|BBa_J06504]]) which was amplified from [[Part:BBa_J06702|BBa_J06702]]. The part was generated by [http://openwetware.org/wiki/Assembly_pcr Assembly_pcr]. This part was to be used in order to characterize the effect of theophylline concentration on the level of translation of the mCherry protein. false false _1039_ 0 11677 9 In stock false The theophylline riboswitch had to be directly fused to the start codon of the mCherry protein. To achieve this, [http://openwetware.org/wiki/Assembly_pcr Assembly_pcr] was used. false Ilya Vainberg Slutskin component2182907 1 BBa_K784005 component2182910 1 BBa_J06504 annotation2182910 1 BBa_J06504 range2182910 1 75 788 annotation2182907 1 BBa_K784005 range2182907 1 1 74 BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 annotation1585829 1 mCherry range1585829 1 1 711 BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_K784005_sequence 1 gactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaag BBa_K784006_sequence 1 gactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z