BBa_K784007 1 BBa_K784007 Spacer + RBS from theophylline riboswitch 2012-09-14T11:00:00Z 2015-05-08T01:13:21Z There is no source for this part. The RBS is the one used in the [[Part:BBa_K784005|theophylline riboswitch]]. This part has been created by deleting the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]] using PCR. In addition, the deleted regions were replaced by a spacer region, which was added using the primers. The spacer region contains a PacI restriction site. As a result, only the RBS from the [[Part:BBa_K784005|theophylline riboswitch]] remains. false false _1039_ 0 11677 9 Not in stock false The spacer region was designed to have minimal secondary structures. In particular, it was designed to have minimal base pairs in the with the RBS, in order to keep it free for interaction with the ribosome. The PacI restriction site in the spacer region was used to self ligate the PCR product, which was a complete plasmid without the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]]. false Ilya Vainberg Slutskin annotation2183227 1 Spacer region range2183227 1 1 27 annotation2183229 1 RBS range2183229 1 28 46 annotation2183228 1 PacI restriction site range2183228 1 12 19 BBa_K784007_sequence 1 tctctctctctttaattaatctctctcctgctaaggtaacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z