BBa_K784008 1 BBa_K784008 MCS+tac promoter 2012-09-14T11:00:00Z 2015-05-08T01:13:21Z A pUC19 plasmid sent to us from the [http://www.gallivanlab.org/ Gallivan lab]. The promoter was followed by the [[Part:BBa_K784005|theophylline riboswitch]]. The tac promoter is a functional hybrid promoter, derived from the trp and lac promoters. The sequence here is preceded by an MCS as a by product of the restriction cloning steps from a pUC19 plasmid which contained the original sequence. The promoter was followed by the [[Part:BBa_K784005|theophylline riboswitch]] and the complete construct was used for the [http://openwetware.org/wiki/Assembly_pcr Assembly pcr] process with different proteins. false false _1039_ 0 11677 9 Not in stock false There are no design considerations. false Ilya Vainberg Slutskin annotation2183230 1 MCS range2183230 1 1 21 annotation2183231 1 tac promoter range2183231 1 22 61 BBa_K784008_sequence 1 gagctcggtacccggggatccgagctgttgacaattaatcatcggctcgtataatgtgtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z