BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585829 1 mCherry range1585829 1 1 711 annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 BBa_K784012 1 BBa_K784012 Spacer2 + RBS from theophylline riboswitch 2012-09-15T11:00:00Z 2015-05-08T01:13:21Z The spacer region was designed to have minimal secondary structures. In particular, it was designed to have minimal base pairs in the with the RBS, in order to keep it free for interaction with the ribosome. The PacI restriction site in the spacer region was used to self ligate the PCR product, which was a complete plasmid without the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]]. This part has been created by deleting the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]] using PCR. In addition, the deleted regions were replaced by a spacer region, which was added using the primers. The spacer region contains a PacI restriction site. As a result, only the RBS from the [[Part:BBa_K784005|theophylline riboswitch]] remains.<br> This part is the result of an insertion mutation to [[Part:BBa_K784007|BBa_K784007]]. false false _1039_ 0 11677 9 Not in stock false There is no source for this part. The RBS is the one used in the [[Part:BBa_K784005|theophylline riboswitch]]. false Ilya Vainberg Slutskin annotation2183610 1 RBS range2183610 1 33 51 annotation2183611 1 PacI restriction site range2183611 1 17 24 annotation2183609 1 Spacer2 range2183609 1 1 32 BBa_K784009 1 BBa_K784009 Spacer2+RBS+mCherry 2012-09-14T11:00:00Z 2015-05-08T01:13:21Z This part was received in a pUC19 plasmid from [http://www.gallivanlab.org/ Gallivan lab]. This is a construct containing an [[Part:BBa_K784008|MCS followed by a tac promoter]] followed by the [[Part:BBa_K784005|theophylline riboswitch]]. This construct is one of the two fragments used for the [http://openwetware.org/wiki/Assembly_pcr Assembly pcr] of the [[Part:BBa_K784005|theophylline riboswitch]] with different proteins. false false _1039_ 0 11677 9 Not in stock false There were no design considerations. false Ilya Vainberg Slutskin component2183633 1 BBa_K784012 component2183636 1 BBa_J06504 annotation2183633 1 BBa_K784012 range2183633 1 1 51 annotation2183636 1 BBa_J06504 range2183636 1 52 765 BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_K784012_sequence 1 tctctctctctttagattaattaatctctctcctgctaaggtaacaacaag BBa_K784009_sequence 1 tctctctctctttagattaattaatctctctcctgctaaggtaacaacaagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z