BBa_K784008 1 BBa_K784008 MCS+tac promoter 2012-09-14T11:00:00Z 2015-05-08T01:13:21Z A pUC19 plasmid sent to us from the [http://www.gallivanlab.org/ Gallivan lab]. The promoter was followed by the [[Part:BBa_K784005|theophylline riboswitch]]. The tac promoter is a functional hybrid promoter, derived from the trp and lac promoters. The sequence here is preceded by an MCS as a by product of the restriction cloning steps from a pUC19 plasmid which contained the original sequence. The promoter was followed by the [[Part:BBa_K784005|theophylline riboswitch]] and the complete construct was used for the [http://openwetware.org/wiki/Assembly_pcr Assembly pcr] process with different proteins. false false _1039_ 0 11677 9 Not in stock false There are no design considerations. false Ilya Vainberg Slutskin annotation2183230 1 MCS range2183230 1 1 21 annotation2183231 1 tac promoter range2183231 1 22 61 BBa_K784011 1 BBa_K784011 MCS+tac promoter+Spacer+RBS+mCherry 2012-09-14T11:00:00Z 2015-05-08T01:13:21Z [http://openwetware.org/wiki/Assembly_pcr Assembly pcr] product of [[Part:BBa_K784008|MCS+tac promoter]] + [[Part:BBa_K784005|theophylline riboswitch]] with [[Part:BBa_J06504|mCherry]]. This is a construct containing an [[Part:BBa_K784008|MCS followed by a tac promoter]] followed by the [[Part:BBa_K784007|sapcer+RBS from theophylline riboswitch]] fused to mCherry. The construct was created using [http://openwetware.org/wiki/Assembly_pcr Assembly pcr]. This construct was used to characterize the relationship between the theophylline concentration and the level of translation of mCherry fused to the theophylline riboswitch.<br> The physical DNA of this part has been submitted in pSB1C3 to the registry. However, it hasn't been clones using the biobrick prefix and suffix. It has been inserted using the EcoRI and PstI restriction sites, destroying the biobrick prefix and suffix. false false _1039_ 0 11677 9 It's complicated true No design considerations. false Ilya Vainberg Slutskin component2183336 1 BBa_K784007 component2183339 1 BBa_J06504 component2183332 1 BBa_K784008 annotation2183339 1 BBa_J06504 range2183339 1 108 821 annotation2183332 1 BBa_K784008 range2183332 1 1 61 annotation2183336 1 BBa_K784007 range2183336 1 62 107 BBa_K784007 1 BBa_K784007 Spacer + RBS from theophylline riboswitch 2012-09-14T11:00:00Z 2015-05-08T01:13:21Z There is no source for this part. The RBS is the one used in the [[Part:BBa_K784005|theophylline riboswitch]]. This part has been created by deleting the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]] using PCR. In addition, the deleted regions were replaced by a spacer region, which was added using the primers. The spacer region contains a PacI restriction site. As a result, only the RBS from the [[Part:BBa_K784005|theophylline riboswitch]] remains. false false _1039_ 0 11677 9 Not in stock false The spacer region was designed to have minimal secondary structures. In particular, it was designed to have minimal base pairs in the with the RBS, in order to keep it free for interaction with the ribosome. The PacI restriction site in the spacer region was used to self ligate the PCR product, which was a complete plasmid without the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]]. false Ilya Vainberg Slutskin annotation2183227 1 Spacer region range2183227 1 1 27 annotation2183229 1 RBS range2183229 1 28 46 annotation2183228 1 PacI restriction site range2183228 1 12 19 BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 annotation1585829 1 mCherry range1585829 1 1 711 BBa_K784007_sequence 1 tctctctctctttaattaatctctctcctgctaaggtaacaacaag BBa_K784008_sequence 1 gagctcggtacccggggatccgagctgttgacaattaatcatcggctcgtataatgtgtgg BBa_K784011_sequence 1 gagctcggtacccggggatccgagctgttgacaattaatcatcggctcgtataatgtgtggtctctctctctttaattaatctctctcctgctaaggtaacaacaagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z