BBa_K784012 1 BBa_K784012 Spacer2 + RBS from theophylline riboswitch 2012-09-15T11:00:00Z 2015-05-08T01:13:21Z The spacer region was designed to have minimal secondary structures. In particular, it was designed to have minimal base pairs in the with the RBS, in order to keep it free for interaction with the ribosome. The PacI restriction site in the spacer region was used to self ligate the PCR product, which was a complete plasmid without the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]]. This part has been created by deleting the aptamer and the additional 5' UTR regions of the [[Part:BBa_K784005|theophylline riboswitch]] using PCR. In addition, the deleted regions were replaced by a spacer region, which was added using the primers. The spacer region contains a PacI restriction site. As a result, only the RBS from the [[Part:BBa_K784005|theophylline riboswitch]] remains.<br> This part is the result of an insertion mutation to [[Part:BBa_K784007|BBa_K784007]]. false false _1039_ 0 11677 9 Not in stock false There is no source for this part. The RBS is the one used in the [[Part:BBa_K784005|theophylline riboswitch]]. false Ilya Vainberg Slutskin annotation2183609 1 Spacer2 range2183609 1 1 32 annotation2183610 1 RBS range2183610 1 33 51 annotation2183611 1 PacI restriction site range2183611 1 17 24 BBa_K784012_sequence 1 tctctctctctttagattaattaatctctctcctgctaaggtaacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z