BBa_K784023 1 BBa_K784023 MCS in pSB1C3 2012-09-16T11:00:00Z 2015-05-08T01:13:22Z Hybridized from two single stranded DNA sequences and cloned into pSB1C3 using the XbaI site and the BioBrick suffix. The sequence below has been created in order to expand the number of restriction sites available for shipping BioBricks in [[Part:pSB1C3|pSB1C3]]. If you want to ship a sequence that can't be digested with restriction sites found in the BioBrick prefix or suffix, this MCS can be the solution.<br> The addition of the MCS to the [[Part:pSB1C3|pSB1C3]] backbone resulted in a change in the BioBrick prefix. This was in order to add the BglII restriction site in overlap to the XbaI restriction site from the prefix.<br> The restriction sites available in the MCS are: BglII, HindIII, PacI and BamHI. These restriction sites are preceded by the EcoRI, NotI and XbaI sites from the BioBrick prefix. They are also followed by the SpeI, NotI and PstI sites from the BioBrick suffix. false false _1039_ 0 11677 9 It's complicated true The sequence was limited to in length to the single stranded DNA cost. The sites included were the one's that were assumed useful for our team's iGEM project. The PacI site was required for cloning the Lambda phage fragments, since that restriction site was absent in phage genome.<br> The BglII site overlaps with the XbaI site from the prefix in order to maximize the number of restriction sites in a short sequence of DNA. false Ilya Vainberg Slutskin annotation2183975 1 BamHI range2183975 1 22 27 annotation2183973 1 HindIII range2183973 1 10 15 annotation2183972 1 Half of BglII range2183972 1 1 3 annotation2183974 1 PacI range2183974 1 14 21 BBa_K784023_sequence 1 tctgtcgacaagcttaattaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z