BBa_K784025 1 BBa_K784025 K1F promoter 2012-09-16T11:00:00Z 2015-05-08T01:13:22Z Temme Karsten, et al. 2012. Modular control of multiple pathways using engineered orthogonal T7 polymerases. Nucleic Acids Research (advance access): 1-9. This part has the K1F RNA Polymerase promoter false false _1039_ 0 11982 9 Not in stock false no particular considerations false Lior Levy BBa_K784025_sequence 1 taataactatcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z