BBa_K784041 1 BBa_K784041 pTetO+ mCherry (FP) 2012-09-24T11:00:00Z 2015-05-08T01:13:22Z The lab of Roee Amit: [http://roee-amit.technion.ac.il/] This part includes 2 inducible promoters of pTetO (activated by tetracycline), for reducing the leakiness of this promoter, and a red fluorescence protein (mCherry). This part was donated to us by Roee Amit, and was sequence confirmed by him. The part is present in plasmid pSB1C3, with the standard prefix and suffix, but the sequence of the part contains EcoRI and PstI restriction sites, so the optimal solution will be using this part in Gibson assembly reaction. This part places mCherry downstream to the pTetO promoter. Reported activities of the promoters are given in strain Top10 grown in LB media. The activity of this promoter in this bacteria strain is constitutive and the fluorescence measure results can be seen at the "results for this part" section. This part can be used for inducible/constitutive expression (depends on the bacteria's strain) of the FP, and can be combined with other genes. Cloning this part was done by amplifying the promoter and the FP together, adding XbaI site in the 5' and SpeI in the 3' ends, for cloning it to the registry plasmids. false false _1039_ 0 11677 9 It's complicated false This part have EcoRI and PstI restriction sites, this will be a problem when trying to clone this part by restriction to the registry plasmids. An alternative solution can be the Gibson assembly reaction, which doesn???t require digestion at all, no matter what is the restriction site is, you can clone it to any of the registry plasmids. false Inbal Vaknin annotation2197163 1 mCherry range2197163 1 102 812 annotation2197162 1 pTetO (2) range2197162 1 26 44 annotation2197205 1 MCS range2197205 1 816 845 annotation2197149 1 pTetO (1) range2197149 1 1 19 annotation2197164 1 RBS range2197164 1 83 91 BBa_K784041_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgaccgaattcattaaagaggagaaaggtaccatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaaactagatctgtcgacaagcttaattaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z