BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K785001 1 BBa_K785001 T7 promoter and RBS 2012-09-20T11:00:00Z 2015-05-08T01:13:22Z T7 promoter is BBa_I712074. RBS is BBa_B0032. This part is T7 promoter and a downstream RBS. The RBS is a medium RBS which related efficiency is 0.3. false false _1040_ 0 11000 9 It's complicated false This part is used for constructing a protein expression system under T7 promoter. false Zining Hou component2191524 1 BBa_B0032 component2191522 1 BBa_I712074 annotation2191524 1 BBa_B0032 range2191524 1 55 67 annotation2191522 1 BBa_I712074 range2191522 1 1 46 BBa_B0032_sequence 1 tcacacaggaaag BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K785001_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagtcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z