BBa_K785004 1 BBa_K785004 Lov-HTH (light sensor with Ptet repression) light->PtetO repressed 2012-09-22T11:00:00Z 2015-05-08T01:13:22Z The sequence is reverse translated from the protein EL222 http://www.rcsb.org/pdb/explore/explore.do?structureId=3P7N which is from Erythrobacter litoralis. The DNA is synthesized by Invitrogen company. This page is about a light sensor and regulator protein: Lov-HTH. Lov-HTH is a artificial light sensor designed by iGEM12 Fudan Lux team. This protein include two function domain, Lov the light sensing domain and HTH the DNA binding domain. false false _1040_ 0 11000 9 Not in stock false The HTH motif swap is the main issue in our design. We carefully choose the HTH sequence and swap it into the original amino acid sequence. false Zining Hou annotation2194602 1 Lov light sensing domain range2194602 1 1 291 annotation2194603 1 HTH DNA binding domain range2194603 1 292 672 BBa_K785004_sequence 1 atgggtcaggatcgtccgattgatggtagtggtgcaccgggtgcagatgatacccgtgttgaagttcagcctccggcacagtgggttctggatctgattgaagcaagcccgattgcaagcgttgttagcgatccgcgtctggcagataatccgctgattgcaattaatcaggcatttaccgatctgaccggttatagcgaagaagaatgcgttggtcgtaattgtcgttttctggcaggtagcggcaccgaaccgtggctgaccgataaaattcgtcagggtgttcgtgaacataaaccggttctggttgaaatcctgaactacaaaaaagatggcaccccgtttcgtaatgcagttctggtggcaccgatttatgatgatgacgatgaactgctgtattttctgggtagccaggttgaagttgatgatgatcagccgaatatgggtatggcacgtcgtgaacgtgcagcagaaatgctgaaaaccctgagtccgcgtcagctggaagttaccaccctggttgcaagcggtctgaccacccgtaaactggcacagaaactgggtgttgaacagccgaccctgtattggcatgttaaactggttatggaaaaactgaacctgaaaaccagcgcagatctggttcgtattgccgttgaagcaggtatttgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z