BBa_K792000 1 BBa_K792000 Yeast exportable His-rich peptide w/enhanced import (nonStd) 2012-09-23T11:00:00Z 2015-05-08T01:13:22Z Different sources. Refer to composite part X registry entry for more information. Released HQ 2013 IMPORTANT: This is a direct synthesis of the part X, so it does not contain BB assembly standard scars. From a functional point of view, it should be equivalent to part X. For more information, look the entry of that part (link) true false _1047_ 0 11811 9 Discontinued false Codon and secondary structure optimized for yeast. false Manuel Gim??nez BBa_K792000_sequence 1 ggatccacgattaaaagaatgagattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggctaagctttatggtagaaaaaagcgtagacaacgtagaagaaagcttcacaaccataatcacaaccacaatcataaccacaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z