BBa_K792001 1 MFa1-Kozak Kozak sequence from yeast α-factor mating pheromone (MFα1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=MFA1 The Kozak sequence is the eukaryotic analog of the bacterial RBS, it is short sequence that includes the ATG, required for proficient initiation of translation. It is known that the 5???UTR sequence of the MFα1 gene of yeast produces efficient initiation of translation. This part is that specific region of the MFα1 gene. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197871 1 rbs range2197871 1 7 21 annotation2197870 1 BamHI restriction site range2197870 1 1 6 annotation2197872 1 start range2197872 1 19 21 BBa_K792001_sequence 1 ggatccacgattaaaagaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z