BBa_K792003 1 TAT-trojan Import enhancer - HIV TAT penetratin (trojan peptide) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z HIV TAT penetratin Trojan peptides are short sequences that penetrate through the plasma membrane inside the cell without the need of any receptor or endocitosis process [Derossi 1998]. They can be used to increase the efficiency with which a protein enters a cell. This part is the penetratin from the HIV TAT protein, and has to be used just before the coding sequence of the peptide that you want to be ''import enhanced''. false false _1047_ 0 11811 9 Not in stock true Sequence obtained by retro-translation false Manuel Gim??nez annotation2197881 1 Trojan peptide range2197881 1 7 39 annotation2196325 1 HindIII restriction site range2196325 1 1 6 BBa_K792003_sequence 1 aagctttatggtagaaaaaagcgtagacaacgtagaaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z