BBa_K792004 1 Polyargini Import enhancer - Polyarginine (trojan peptide) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Characterisation of cell-penetrating peptide-mediated peptide delivery [Jones et al 2005] Trojan peptides are short sequences that penetrate through the plasma membrane inside the cell without the need of any receptor or endocitosis process [Derossi 1998]. They can be used to increase the efficiency with which a protein enters a cell. This part is Polyarginine, and has to be used just before the coding sequence of the peptide that you want to be import enhanced. (refer to ''Characterisation of cell-penetrating peptide-mediated peptide delivery'' [Jones et al 2005] for more information about polyarginine) false false _1047_ 0 11811 9 Not in stock false Sequence obtained by retro-translation. Codon and mRNA-secondary structure optimized for yeast. false Manuel Gim??nez annotation2196615 1 HindIII restriction site range2196615 1 1 6 annotation2197880 1 Trojan peptide range2197880 1 7 39 BBa_K792004_sequence 1 aagcttagaagaagaagaagaagaagacgtcgtcgtaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z