BBa_K792005 1 HisTag Histidine rich peptide (His Tag) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Clontech???s His-tag. Stable and soluble Histidine rich peptide. false false _1047_ 0 11811 9 Not in stock false Retro-translated and optimized (codons and mRNA seconday structure) for yeast. false Manuel Gim??nez annotation2196557 1 stop range2196557 1 43 48 annotation2197882 1 His tag range2197882 1 7 42 annotation2196426 1 HindIII restriction site range2196426 1 1 6 BBa_K792005_sequence 1 aagcttcacaaccataatcacaaccacaatcataaccacaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z