BBa_K792008 1 PolyWb Tryptophan rich peptide (PolyWb) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Designed by BsAs Team 2012 Stable and soluble '''Histidine''' rich peptide (designed in silico) This part has a '''HindIII''' restriction site as extra. false false _1047_ 0 11811 9 Not in stock false PolyWb was desing taking into acount the following consideration: # avoided repeating the same residue in tandem to minimize local tRNA depleation # avoided Trp in tandem because of therir low solubility # we included Gly to avoid the formation of stable structures # included acidic and basic amino acids to increase solubility Sequence obtained by retro-translation. Codon and mRNA-secondary structure optimized for yeast. false Manuel Gim??nez annotation2204264 1 cds range2204264 1 7 114 annotation2196618 1 stop range2196618 1 115 120 annotation2196471 1 HindIII restriction site range2196471 1 1 6 BBa_K792008_sequence 1 aagctttggggtgattgggatggctggggtaaatggaagggttggggcgattgggacggttggggcaaatggaaaggttggggcgactgggatggttggggtaagtggaaaggttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z