BBa_K792010 1 BBa_K792010 Yeast exportable Trp-rich peptide w/enhanced import (1) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Composite device This composite device produces and '''exports''' a '''Histidine rich''' peptide, that is '''import enhanced''' (thanks to a trojan peptide). This device is intended to be used with '''Yeast chassis''', so it is composed by subparts designed also to be use in yeast. The high level structure of the device is: * '''''Kozak''''' consensus sequence for initiation of translation ''(from yeast α-factor mating pheromone (MFα1))'' * '''''Signal''''' peptide that targets the product of the gene for secretion ''(also from yeast α-factor mating pheromone (MFα1))'' * '''''Trojan''''' peptide, to increase internalization in target cell ''(from HIV TAT penetratin)'' * '''''Payload''''': this is the exported '''Histidine''' rich domain of the protein ''(a His-Tag)'' The device's sequence has inherited some useful '''restriction sites''' (''BamHI'' & ''HindIII'') from the parts it's made of. '''Important note''': this part has been submitted to the registry using a direct synthesis DNA sample, so it does not contain scars from ''BB assembly standard''. false false _1047_ 0 11811 9 It's complicated true Composite device false Manuel Gim??nez component2196549 1 BBa_K792006 component2196544 1 BBa_K792001 component2196547 1 BBa_K792003 component2196545 1 BBa_K792002 annotation2196549 1 BBa_K792006 range2196549 1 115 162 annotation2196547 1 BBa_K792003 range2196547 1 76 114 annotation2196544 1 BBa_K792001 range2196544 1 1 21 annotation2196545 1 BBa_K792002 range2196545 1 22 75 BBa_K792001 1 MFa1-Kozak Kozak sequence from yeast α-factor mating pheromone (MFα1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=MFA1 The Kozak sequence is the eukaryotic analog of the bacterial RBS, it is short sequence that includes the ATG, required for proficient initiation of translation. It is known that the 5???UTR sequence of the MFα1 gene of yeast produces efficient initiation of translation. This part is that specific region of the MFα1 gene. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197870 1 BamHI restriction site range2197870 1 1 6 annotation2197872 1 start range2197872 1 19 21 annotation2197871 1 rbs range2197871 1 7 21 BBa_K792006 1 TrpZipper2 Tryptophan rich peptide (TrpZipper2) 2012-09-24T11:00:00Z 2015-05-08T01:13:23Z Tryptophan zippers: Stable, monomeric beta-hairpins [Cochran 2001] '''TrpZipper''' is a small peptide that folds into a beta-hairpin secondary structure. The indole rings of the Trp form a hydrophobic core. The protein is water soluble and monomer. false false _1047_ 0 11811 9 Not in stock false Sequence obtained by retro-translation. Codon and mRNA-secondary structure optimized for yeast. false Manuel Gim??nez annotation2196458 1 HindIII restriction site range2196458 1 1 6 annotation2196616 1 stop range2196616 1 43 48 annotation2197860 1 cds range2197860 1 7 42 BBa_K792002 1 MFa1-Secre Secretion tag from yeast α-factor mating pheromone (MFα1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Prepro-a-factorHas a Cleavable Signal Sequence [Water et al 1987] This part is the secretion signal peptide for the yeast α-mating factor. This signal peptide directs the secretion of the produced protein, and therefore allows for the exportation of it. This peptides are cleaved once the protein is in the lumen of the ER. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197873 1 secretion tag range2197873 1 1 54 BBa_K792003 1 TAT-trojan Import enhancer - HIV TAT penetratin (trojan peptide) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z HIV TAT penetratin Trojan peptides are short sequences that penetrate through the plasma membrane inside the cell without the need of any receptor or endocitosis process [Derossi 1998]. They can be used to increase the efficiency with which a protein enters a cell. This part is the penetratin from the HIV TAT protein, and has to be used just before the coding sequence of the peptide that you want to be ''import enhanced''. false false _1047_ 0 11811 9 Not in stock true Sequence obtained by retro-translation false Manuel Gim??nez annotation2197881 1 Trojan peptide range2197881 1 7 39 annotation2196325 1 HindIII restriction site range2196325 1 1 6 BBa_K792006_sequence 1 aagctttcctggacctgggaaaacggtaaatggacttggaagtaataa BBa_K792003_sequence 1 aagctttatggtagaaaaaagcgtagacaacgtagaaga BBa_K792010_sequence 1 ggatccacgattaaaagaatgagattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggctaagctttatggtagaaaaaagcgtagacaacgtagaagaaagctttcctggacctgggaaaacggtaaatggacttggaagtaataa BBa_K792002_sequence 1 agattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggct BBa_K792001_sequence 1 ggatccacgattaaaagaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z