BBa_K792014 1 BBa_K792014 Exportable His-rich peptide generator 2012-09-25T11:00:00Z 2015-05-08T01:13:23Z Complete Complete false false _1047_ 0 11811 9 Not in stock false Complete false Manuel Gim??nez component2202200 1 BBa_K133035 component2202202 1 BBa_K133035 component2202199 1 BBa_K125310 component2202203 1 BBa_B0024 component2202197 1 BBa_J04500 component2202201 1 BBa_K133035 annotation2202199 1 BBa_K125310 range2202199 1 229 281 annotation2202201 1 BBa_K133035 range2202201 1 315 335 annotation2202200 1 BBa_K133035 range2202200 1 288 308 annotation2202203 1 BBa_B0024 range2202203 1 371 465 annotation2202202 1 BBa_K133035 range2202202 1 342 362 annotation2202197 1 BBa_J04500 range2202197 1 1 220 BBa_K133035 1 Met-His Methionine-His affinity tag 2008-10-25T11:00:00Z 2015-05-08T01:09:55Z Part was constructed by primer annealing. His-tag with amino acid Methionine.His-tag is used for detection of His-tagged proteins by anti-His antibodies. false false _231_ 0 3350 9 In stock false Cloned into pSB1AK3 vector. true Jerneja Mori BBa_K125310 1 slr2016 SS slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein 2008-07-24T11:00:00Z 2015-05-08T01:09:44Z The ''slr2016'' signal sequence is located at the amino terminus of slr2016 polypeptides synthesized by ''Synechocystis'' sp. PCC 6803. false false _179_ 0 3229 9 In stock false false Krystle Salazar and Grace Kwan annotation1968259 1 slr2016 signal sequence range1968259 1 1 53 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 BBa_B0024 1 BBa_B0024 double terminator (B0012-B0011), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508159 1 BBa_B0034 range1508159 1 209 220 annotation1508149 1 BBa_R0010 range1508149 1 1 200 BBa_B0024_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K125310_sequence 1 tggcagcaaaacaactatggaaaattttcaatcctagaccgatgaagggtgga BBa_K133035_sequence 1 atgcaccaccaccaccaccac BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K792014_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagagtggcagcaaaacaactatggaaaattttcaatcctagaccgatgaagggtggatactagatgcaccaccaccaccaccactactagatgcaccaccaccaccaccactactagatgcaccaccaccaccaccactactagagaaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z