BBa_K797002 1 BBa_K797002 TorA signal with RBS 2012-09-19T11:00:00Z 2015-05-08T01:13:23Z This parts is derived from Escherichia coli???s genomic sequence. This part is coding N-terminal torA signal region. Proteins conjugated torA signal are recognized by Tat secretion pathway and they are secreted from cytoplasm to periplasm while maintaining their holdings. This parts include RBS so that you don't bother to insert new RBS between this signal and your promoter. ( Note: Depending on your purpose,　you might use BBa_K797004 when you use this signal because wild type Tat pathway is relatively saturated easily.) false false _1053_ 0 11588 9 In stock true When you combine two iGEM part by ligation following cutting by Xbal and Spe1,　a stop codon sometimes appear. But don't worry. We modified the sequence of Tat signal so that this signal can always combine your protein. false Tomohiro Nobeyama annotation2195230 1 Modified torA with RBS range2195230 1 1 192 BBa_K797002_sequence 1 taaggctcacggcgataagaaggaagaaaaataatgaacaataacgatctctttcaggcatcacgtcggcgttttctggcacaactcggcggcttaaccgtcgccgggatgctggggccgtcattgttaacgccgcgacgtgcgactgcggcgcaagcggcgactgacgctgtcatctcgaaagagggcatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z