BBa_K797009 1 BBa_K797009 Plasmid include TorA-R9 signal region 2012-09-19T11:00:00Z 2015-05-08T01:13:23Z This part was synthesized artificiallt This Plasmid include N terminal TorA signal region followed by R9 signal region false false _1053_ 0 11588 9 It's complicated false false Tomohiro Nobeyama annotation2195270 1 R9 range2195270 1 130 156 annotation2195274 1 torA range2195274 1 48 129 BBa_K797009_sequence 1 atgaacaataacgatctctttcaggcatcacgtcggcgttttctggcacaactcggcggcttaaccgtcgccgggatgctggggccgtcattgttaacgccgcgacgtgcgactgcggcgcaagcggcgcgtcgtcgtcgtcgtcgtcgtcgtcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z