BBa_K797014 1 BBa_K797014 T7 RBS 6His R9 2012-09-21T11:00:00Z 2015-05-08T01:13:23Z We can extract proteins by His tag, and penetrate proteins into cells by R9 sequence. false false _1053_ 0 11588 9 It's complicated true false Tomohiro Nobeyama annotation2195924 1 T7 range2195924 1 1 20 annotation2195926 1 R9 peptide range2195926 1 71 97 annotation2195309 1 RBS range2195309 1 32 43 annotation2195925 1 6-Histag range2195925 1 53 70 BBa_K797014_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatgcaccatcaccatcaccatcgtcgtcgtcgtcgtcgtcgtcgtcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z