BBa_K797017 1 BBa_K797017 This part is inserted in BBa_K797013 2012-10-02T11:00:00Z 2015-05-08T01:13:23Z This part was synthesized artificially This parts include restriction and recognition cite of Bsa1. When you use it for Golden Gate Assembly, don't cut and take out this parts. false false _1053_ 0 11588 9 No part sequence false ctagagtccatgagaccaaatttggactc false Tomohiro Nobeyama igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z