BBa_K798001 1 BBa_K798001 600bp overlong telomere repeats of Saccharomyces cerevisiae 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Synthetized based on the character of the yeast's telomere sequence This part is a 600bp overlong telomere repeats of Saccharomyces cerevisiae(its general length is about 300bp). According to some researches before, the overlong telomere in the yeast will decrease by 2-3bp per generation. Thus, we can insert some key regulation sequence (but the sequence has to be very small, <100bp) in the overlong part of the telomere sequence. After recombination into the yeast chromosome, the telomere begins to decrease and about 70 generations later the key sequence will be cut off which can have an effect on the regulation. Obviously, the main advantage of the design is that we can change the regulation procedurally and predictably. true false _1054_ 0 14455 9 Discontinued false We inserted a ribozyme sequence shorter than 40bp into the overlong part of the telomere. The ribozyme sequence is able to recognize the target substrate sequence in the 5??? UTR region of the target gene and then down-regulate the gene expression. If the target gene is negative for an essential gene of Yeast, after the ribozyme sequence is damaged with the decrease of the telomere (after about 140 generations), the yeast will be dead. Thus, it can be used to construct an engineering yeast with a fixed life span. false Taijie Jin annotation2195762 1 Telomere repeats range2195762 1 7 600 BBa_K798001_sequence 1 tctagagtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtgtgtgtgggtgtactagagtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtgtgtgtgggtgtactagagtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtgtgtgtgggtgtactagagtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtggtgtgtgggtgtgtgtgtgggtgtactagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z