BBa_K798007 1 BBa_K798007 substrate sequence-ribozyme sequence 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Constructed from the substrate sequence of ribozyme, a 600bp irrelevant DNA sequence and the ribozyme sequence This part consists of the substrate sequence and the custom Ribozyme Sequence 1. And the length of the interval sequence is approximately 620bp. By adding this part after the 5???UTR region of any genes, the expression can be down-regulated false false _1054_ 0 14455 9 Not in stock false We link the substrate sequence and ribozyme sequence with a nearly 620bp interval sequence, so after adding this part in the 5??? UTR region of an arbitrary gene, the gene can be knocked down. false Taijie Jin component2248193 1 BBa_K798003 component2248189 1 BBa_C0061 component2248187 1 BBa_K798005 annotation2248187 1 BBa_K798005 range2248187 1 1 18 annotation2248189 1 BBa_C0061 range2248189 1 25 642 annotation2248193 1 BBa_K798003 range2248193 1 676 722 BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1761 1 luxI range1761 1 1 579 annotation1760 1 LVA range1760 1 580 611 annotation7038 1 BBa_C0061 range7038 1 1 618 annotation2213985 1 Help:Barcodes range2213985 1 619 643 BBa_K798005 1 BBa_K798005 Recognition sequence of ribozyme sequence 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Designed and synthetized based on some ribozyme researches This part is the recognition sequence of ribozyme sequence. It can be inserted together with the ribozyme sequence into the 5???UTR region of any genes. As a result, it can down-regulate the expression of the gene and even entirely silence the gene. The substrate sequence should be in front of the ribozyme sequence. Besides, the length of interval sequence between ribozyme and substrate is alterable from 0 to nearly 1000 bp. false true _1054_ 0 14455 9 It's complicated false It should be recognized by the ribozyme sequence so that it can influence the expression of the target gene. false Taijie Jin annotation2195786 1 Substrate of ribozyme range2195786 1 1 18 BBa_K798003 1 BBa_K798003 Ribozyme sequence 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Designed and synthetized based on some ribozyme researches This part is a ribozyme sequence whose design is based on the phenomena that structured RNAs embedded in the untranslated regions (UTRs) of messenger RNAs can regulate gene expression (Martick, Horan et al. 2008). It can be inserted with its target substrate sequence into the 5???UTR region of any genes and as a result down-regulate the expression of the gene or even entirely silence the gene. The ribozyme sequence should be after the substrate sequence. Besides, the length of interval sequence between ribozyme and substrate is alterable from 0 to nearly 1000 bp. false false _1054_ 0 14455 9 Not in stock false Due to its short length and its down-regulation function for target genes, we insert it into the overlong telomere part as a regulation switch. Once it is damaged with the decrease of telomere, the switch will be off and the expression of the target gene will be normal. false Taijie Jin annotation2195770 1 Ribozyme range2195770 1 13 41 BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_K798007_sequence 1 atcgataccgtcacgcgttactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagaggaattctctagaacgcgtctgatgagcgaaacggtatcgatactagt BBa_K798003_sequence 1 gaattctctagaacgcgtctgatgagcgaaacggtatcgatactagt BBa_K798005_sequence 1 atcgataccgtcacgcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z