BBa_K798012 1 BBa_K798012 Ribozyme sequence 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Designed and synthetized based on some ribozyme researches This part is a ribozyme sequence whose design is based on the phenomena that structured RNAs embedded in the untranslated regions (UTRs) of messenger RNAs can regulate gene expression (Martick, Horan et al. 2008). It can be inserted with its target substrate sequence into the 5???UTR region of any genes and as a result down-regulate the expression of the gene or even entirely silence the gene. The ribozyme sequence should be after the substrate sequence. Besides, the length of interval sequence between ribozyme and substrate is alterable from 0 to nearly 1000 bp. false false _1054_ 0 14455 9 It's complicated false Due to its short length and its down-regulation function for target genes, we insert it into the overlong telomere part as a regulation switch. Once it is damaged with the decrease of telomere, the switch will be off and the expression of the target gene will be normal. false Taijie Jin annotation2195895 1 ribozyme range2195895 1 1 29 BBa_K798012_sequence 1 acgcgtctgatgagcgaaacggtatcgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z