BBa_K801005 1 BBa_K801005 RFC25 MCS for optional addition of C-terminal Strep-Tag 2012-10-01T11:00:00Z 2015-05-08T01:13:24Z This part has been rationally designed by Team TU Munich 2012. It has been physically prepared by oligo-hybridization. This Part is a multiple cloning site and is found in TU Munich's yeast vectors pTUM100, pTUM104 (BBa_K801000, BBa_K801004). There, it lies between an RFC10 prefix (restriction sites EcoRI, XbaI) and an RFC25 suffix (restriction sites AgeI, SpeI, PstI). It has an internal NgoMIV restriction site, which is necessary for c-terminal fuison of a Strep-Tag to a CDS. Depending of the restriction enzymes used, the Streptag is either removed or added to the 3'-end of the CDS of choice. Application of this part: '''For simple insertion of a CDS into the vector:''' * Use your favorite RFC10 restriction enzymes to digest both the vector and the insert. * Ligate and transform your ''E. coli'' strain of choice '''For insertion of a CDS in front of the strep-tag, creating a "CDS-strep" fusion protein:''' * Insert must be RFC25 compatible and have an RFC25 suffix * Digest vector with XbaI and NgoMIV * Digest insert with XbaI and AgeI * Ligate and transform your ''E. coli'' strain of choice false false _1057_ 0 9982 9 It's complicated false - false Simon Heinze annotation2206406 1 NgoMIV-site necessary for fusion of strep-tag range2206406 1 14 19 annotation2206407 1 strep-tag range2206407 1 20 42 BBa_K801005_sequence 1 ggtaccctcgaggccggcgcttggtctcacccgcagttcgaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z