BBa_K806002 1 BBa_K806002 hda - regulator of DnaA that prevents premature reinitiation of DNA replication 2012-09-23T11:00:00Z 2015-05-08T01:13:25Z we clone the gene in BL21 strain of E.coli, by using primer hda-F and hda-R hda-F sequence: GCTCTAGAGCCTGAACACACCGGCACAGCTCTCT hda-R sequence: GGACTAGTCCCTACAACTTCAGAATTTCTTTCACAAACGGA hda genebank id: AM946981.2 We find a better way to slow down the cell cycle of E.coli,by stop the initiation of DNA replication. Hda is a great candidate for stop replication initiation.[1] we cloned and overexpressed it to slow down certain kind of cells in a mix quorum system, in order to maintain a more stable system and achieve better energy partition. [1] Elliott Crooke et al.EMBO report. Hda inactivation of DnaA is the predominant mechanism preventing hyperinitiation of Escherichia coli DNA replication. false false _1063_ 0 11692 9 It's complicated false 1. Add restriction enzyme site on both end 2. clone the gene from genomic DNA extraction for better effect. false Chang Ye annotation2195944 1 hda range2195944 1 1 747 BBa_K806002_sequence 1 ctacaacttcagaatttctttcacaaacggaatggtcagcttacgttgcgcggtaatcgacgcacgatccaactgatccaacgtcataaatagcgtgcgcatttctctgtcgagccgcttcagcaagaaacgccccacatcttccggcagttcaaaaccacgcaaacgcgcgcgtaactgtagcgcctgcaacttatcttcatcagaaagtggctgcaatttgtagatctgcccccagtcgagtcgcgacgcgagatccggtaatcccagattcaactgccgcggtggacgatcgccggtgatcaacaaccgtgttttgcccgattccagaattcgattgtagagatcgaaaatcgccatctcccacaactcatcgcctgcaatacactcaatgttgtcgatacagaccagcgacaaatgctccataccgtcgagcacttccggaacaaaccaggtgcgtttatccagcgggacatagcccaccgcatcgccacgctgcgacaattccgcgcaagccgcgtgcagcagatggctgcgccccgcgccttcgcgtgcccagagatagatgtaaccgctatgttcctgacgcagcacgttttgcagcgcggccagtaaagaggagttatcccccggccagaaacttgcaaaggtttcgtcgtcaggaagataaagtggcaaagagagctgtgccggtgtgttcagagatacctcaaccaggatttcacaaaatcgcgagaagtttaccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z