BBa_K806003 1 BBa_K806003 SeqA regulation of chromosome replication by preventing re-initiation at newly replicated origins 2012-09-23T11:00:00Z 2015-05-08T01:13:25Z We clone this Gene from E.coli strain BL21 with primer seqA-F and seq-R seqA-F sequence: GCTCTAGAGCATGAAAACGATTGAAGTTGATG seqA-R sequence: GGACTAGTCCTTAGATAGTTCCGCAAACCTTC We find a better way to slow down the cell cycle of E.coli,by stop the initiation of DNA replication. iciA is ???the gene encoding the protein that binds the three 13-mers in the origin (oriC) of Escherichia coli to block initiation of replication in vitro??? we cloned and overexpressed it to slow down certain kind of cells in a mix quorum system, in order to maintain a more stable system and achieve better energy partition. false false _1063_ 0 11692 9 It's complicated false 1. Add restriction enzyme site on both end 2. clone the gene from genomic DNA extraction for better effect. false Chang Ye annotation2195968 1 SeqA range2195968 1 1 546 BBa_K806003_sequence 1 atgaaaacgattgaagttgatgatgaactctacagctatattgccagccacactaagcatatcggcgagagcgcatccgacattttacggcgtatgttgaaattttccgccgcatcacagcctgctgctccggtgacgaaagaggttcgcgttgcgtcacctgctatcgtcgaagcgaaaccggtcaaaacgattaaagacaaggttcgcgcaatgcgtgaacttctgctttcggacgaatacgcagagcaaaagcgagcggtcaatcgctttatgctgctgttgtctacactatattctcttgacgcccaggcgtttgccgaagcaacggaatcgttgcacggtcgtacacgcgtttactttgcggcagatgaacaaacgctgctgaaaaatggtaatcagaccaagccgaaacatgtgccaggcacgccgtattgggtgatcaccaacaccaacaccggccgtaaatgcagcatgatcgaacacatcatgcagtcgatgcaattcccggcggaattgattgagaaggtttgcggaactatctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z